About   Help   FAQ
Rbpms2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rbpms2em1(IMPC)J
Name: RNA binding protein with multiple splicing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755482
Synonyms: Rbpms2em1J
Gene: Rbpms2  Location: Chr9:65536930-65567810 bp, + strand  Genetic Position: Chr9, 35.43 cM
Alliance: Rbpms2em1(IMPC)J page
IMPC: Rbpms2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rbpms2-7534J-F9923 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGTAGAGAGGGCCCCAGA, GCTGTAAGACTTTTCCACAA, ACATATTCAGATCCTGAGAT, and TCTAGGCTGAGCCAGAGGGC, which resulted in a 270 bp deletion spanning exon 6 beginning at Chromosome 9 positive strand position 65,650,854 bp, CAACCTTCTGGGGCCCTCTCT and ending after CCTTCTCCTGCCCTCTGGCT at 65,651,123 bp (GRCm38/mm10). This mutation deletes exon 6 and 119 bp of flanking intronic sequence including the splice acceptor and donor. In addition to the large defined deletion there are two small deletions of 6 bp (CTTTCC) and 19 bp upstream of the 270bp deletion that will not affect the results of the exon deletion. This mutation is predicted to cause an amino acid sequence change after residue 69 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rbpms2 Mutation:  204 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory