Rbpms2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbpms2^em1(IMPC)J
• Name: RNA binding protein with multiple splicing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755482
• Synonyms: Rbpms2^em1J
• Gene: Rbpms2 Location: Chr9:65536930-65567810 bp, + strand Genetic Position: Chr9, 35.43 cM
• Alliance: Rbpms2^em1(IMPC)J page
• IMPC: Rbpms2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACATATTCAGATCCTGAGAT, CCTGTAGAGAGGGCCCCAGA, GCTGTAAGACTTTTCCACAA, and TCTAGGCTGAGCCAGAGGGC that targeted exon(s) ENSMUSE00000219309.2. This resulted in deletion(s) of 2 bp (location: Chr9:65558455-65558456; GRCm39), 6 bp (location: Chr9:65558087-65558092; GRCm39), 19 bp (location: Chr9:65558099-65558117; GRCm39), and 270 bp (location: Chr9:65558136-65558405; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rbpms2 Mutation: 204 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)