About   Help   FAQ
Pdgfrlem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pdgfrlem1(IMPC)J
Name: platelet-derived growth factor receptor-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755394
Synonyms: Pdgfrlem1J
Gene: Pdgfrl  Location: Chr8:41379270-41443819 bp, + strand  Genetic Position: Chr8, 23.89 cM
Alliance: Pdgfrlem1(IMPC)J page
IMPC: Pdgfrl gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Pdgfrl-7448J-M4575 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTAAGGAACCCACAGCAGG, ACTTATGATTATGGCTGAAA, GTTAATACCGCATCTCCCAA, and CTTGGCCTAGCACAATAAAC, which resulted in a 395 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 40,938,018 bp, TTGAAGCCACCTGCTGTGGG and ending after GCATCACTGGCTTCCTGTTTA at 40,938,412 bp (GRCm38/mm10). This mutation deletes exon 2 and 97 bp of flanking intronic sequence including the splice acceptor and donor. There is a small 7bp (GTGGCAT) insertion and coincident deletion of 3 base pairs (AAA)in the intron before the deletion, and an additional 12 bp deletion downstream of the 395 bp exon 2 deletion in the intron, that does not affect the deletion of the exon. This mutation is predicted to result in an early truncation after 19 amino acids. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pdgfrl Mutation:  11 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory