1700001O22Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
1700001O22Rikem1(IMPC)J |
Name: |
RIKEN cDNA 1700001O22 gene; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5755393 |
Synonyms: |
1700001O22Rikem1J |
Gene: |
1700001O22Rik Location: Chr2:30684781-30693673 bp, - strand Genetic Position: Chr2, 21.74 cM
|
Alliance: |
1700001O22Rikem1(IMPC)J page
|
IMPC: |
1700001O22Rik gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutations: |
|
Insertion, Intragenic deletion
|
|
|
Mutation details: This allele from project 1700001O22RIK-7435J-M5756 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGACCCTCTTGATGAAGGA, TGCCTTGAGTGCTACCAAGG, GATGGAGACAGTCCTCGCTT, and GGTGTGTGTGCGCGGAGTCT, which resulted in a 205 bp deletion spanning ENSMUSE00001303738 (exon 2) beginning at Chromosome 2 negative strand position 30,801,093 bp, TCTGGGGTTCCCAAGCGAGG, and ending after CGGAGGGGACCCTCTTGATG at 30,800,889 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. In addition there are 2 small insertions of 14 and 7 bp in the intron sequence, which do not affect the exon deletion. This mutation is predicted to cause an amino acid sequence change after residue 139 and early truncation 139 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|