About   Help   FAQ
1700001O22Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: 1700001O22Rikem1(IMPC)J
Name: RIKEN cDNA 1700001O22 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755393
Synonyms: 1700001O22Rikem1J
Gene: 1700001O22Rik  Location: Chr2:30684781-30693673 bp, - strand  Genetic Position: Chr2, 21.74 cM
Alliance: 1700001O22Rikem1(IMPC)J page
IMPC: 1700001O22Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project 1700001O22RIK-7435J-M5756 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGACCCTCTTGATGAAGGA, TGCCTTGAGTGCTACCAAGG, GATGGAGACAGTCCTCGCTT, and GGTGTGTGTGCGCGGAGTCT, which resulted in a 205 bp deletion spanning ENSMUSE00001303738 (exon 2) beginning at Chromosome 2 negative strand position 30,801,093 bp, TCTGGGGTTCCCAAGCGAGG, and ending after CGGAGGGGACCCTCTTGATG at 30,800,889 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. In addition there are 2 small insertions of 14 and 7 bp in the intron sequence, which do not affect the exon deletion. This mutation is predicted to cause an amino acid sequence change after residue 139 and early truncation 139 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any 1700001O22Rik Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory