About   Help   FAQ
Dalrd3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dalrd3em1(IMPC)J
Name: DALR anticodon binding domain containing 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755383
Synonyms: Dalrd3em1J
Gene: Dalrd3  Location: Chr9:108447085-108449973 bp, + strand  Genetic Position: Chr9, 59.51 cM
Alliance: Dalrd3em1(IMPC)J page
IMPC: Dalrd3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dalrd3-7439J-M5809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAGTTCCGTGGATCCCGCT, GTAAGTGGGCCGTAGTTCCG, GAGTCATGATAATCTAAGCC, and GTGCGTGTTCGAAGCTATAA, which resulted in a 413 bp deletion spanning ENSMUSE00000221392 (exon 2) beginning at Chromosome 9 negative strand position 108,570,528 bp, CAGGCTTAGATTATCATGAC, and ending after GTGTAAGTGGGCCGTAGTTC at 108,570,116 bp (GRCm38/mm10). This mutation deletes exon 2 and 117 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 55 and early truncation 45 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dalrd3 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory