Asb18^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Asb18^em1(IMPC)J
• Name: ankyrin repeat and SOCS box-containing 18; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755382
• Synonyms: Asb18^em1J
• Gene: Asb18 Location: Chr1:89880313-89942388 bp, - strand Genetic Position: Chr1, 45.06 cM
• Alliance: Asb18^em1(IMPC)J page
• IMPC: Asb18 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Asb18-7531J-M9871 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTGGGGTACCTGGACCAGT, CCAAGGGCAGACTTGAGTCG, GGGCAAATGGAAGAACCGGT, and CCGTTTGTTGAGGCTGGAGA, which resulted in a 409 bp deletion spanning exon 3 beginning at Chromosome 1 negative strand position 89,993,301 bp, AGCCTCAACAAACGGCTTAC and ending after TTGGAGGTCTTAGGCCTCGAC at 89,992,893 bp (GRCm38/mm10). This mutation deletes exon 3 and 141 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 110 and early truncation 154 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Asb18 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)