About   Help   FAQ
Asb18em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Asb18em1(IMPC)J
Name: ankyrin repeat and SOCS box-containing 18; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755382
Synonyms: Asb18em1J
Gene: Asb18  Location: Chr1:89880313-89942388 bp, - strand  Genetic Position: Chr1, 45.06 cM
Alliance: Asb18em1(IMPC)J page
IMPC: Asb18 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Asb18-7531J-M9871 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTGGGGTACCTGGACCAGT, CCAAGGGCAGACTTGAGTCG, GGGCAAATGGAAGAACCGGT, and CCGTTTGTTGAGGCTGGAGA, which resulted in a 409 bp deletion spanning exon 3 beginning at Chromosome 1 negative strand position 89,993,301 bp, AGCCTCAACAAACGGCTTAC and ending after TTGGAGGTCTTAGGCCTCGAC at 89,992,893 bp (GRCm38/mm10). This mutation deletes exon 3 and 141 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 110 and early truncation 154 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Asb18 Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/19/2026
MGI 6.24
The Jackson Laboratory