About   Help   FAQ
Hsd17b8em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Hsd17b8em1(IMPC)J
Name: hydroxysteroid 17-beta dehydrogenase 8; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755139
Synonyms: H2-Ke6em1J
Gene: Hsd17b8  Location: Chr17:34245007-34247029 bp, - strand  Genetic Position: Chr17, 17.98 cM
Alliance: Hsd17b8em1(IMPC)J page
IMPC: Hsd17b8 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project H2-Ke6-7445J-M8453 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTAACACCAAAGACCACAA, CACCAAAGACCACAAAGGGC, CCCTTCTTCTCCCGCTTCCG, and GGCTCTCGCTGACATGGCCC, which resulted in a 415 bp deletion spanning ENSMUSE00000300481 (exon 2) beginning at Chromosome 17 negative strand position 34,027,961 bp, CCATGTCAGCGAGAGCCACC and ending after GGCCCTTTGTGGTCTTTGGTG at 34,027,547 bp (GRCm38/mm10). This mutation deletes exon 2 and 197 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 14 and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Hsd17b8 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory