About   Help   FAQ
Rai14em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rai14em1(IMPC)J
Name: retinoic acid induced 14; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755138
Synonyms: Rai14em1J
Gene: Rai14  Location: Chr15:10569055-10714710 bp, - strand  Genetic Position: Chr15, 5.35 cM, cytoband A2
Alliance: Rai14em1(IMPC)J page
IMPC: Rai14 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rai14-7533J-F9911 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTGAAGGCCCCCAAAGCAT, ATACTGGCTTGTTAAGGGTG, AACCGCCTTCCACTTCACCG, and CCATCAGCAAACTCCAACAA, which resulted in a 467 bp deletion spanning exon 3 beginning at Chromosome 15 negative strand position 10,633,455 bp, GTTGGAGTTTGCTGATGGCTG, and ending after ATCAAGGGGAGTTTGACCAAT at 10632989 bp (GRCm38/mm10). This mutation deletes exon 3 and 336 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 12 and early truncation 59 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rai14 Mutation:  163 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory