About   Help   FAQ
Rusc1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rusc1em1(IMPC)J
Name: RUN and SH3 domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755133
Synonyms: Rusc1em1J
Gene: Rusc1  Location: Chr3:88991288-89000618 bp, - strand  Genetic Position: Chr3, 39.01 cM, cytoband F2
Alliance: Rusc1em1(IMPC)J page
IMPC: Rusc1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rusc1-7548J-M2497 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAGATTTAATGTAGTGAGG, TGCAAAGCAAGAGGGTCCAG, TAGCTATCCACCCCAAACCC, and CCAAGGCTCATTCAGAAGGC, which resulted in a 261 bp deletion spanning exon 4 of ENSMUSE00000341390 beginning at Chromosome 3 negative strand position 89,089,651 bp, CTTCTGAATGAGCCTTGGTT and ending after GGCTAGCCACGCCTCTGGACC at 89,089,391 bp (GRCm38/mm10). This mutation deletes exon 4 and 184 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 479 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rusc1 Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory