Rusc1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rusc1em1(IMPC)J |
| Name: |
RUN and SH3 domain containing 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5755133 |
| Synonyms: |
Rusc1em1J |
| Gene: |
Rusc1 Location: Chr3:88991288-89000618 bp, - strand Genetic Position: Chr3, 39.01 cM, cytoband F2
|
| Alliance: |
Rusc1em1(IMPC)J page
|
| IMPC: |
Rusc1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Rusc1-7548J-M2497 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAGATTTAATGTAGTGAGG, TGCAAAGCAAGAGGGTCCAG, TAGCTATCCACCCCAAACCC, and CCAAGGCTCATTCAGAAGGC, which resulted in a 261 bp deletion spanning exon 4 of ENSMUSE00000341390 beginning at Chromosome 3 negative strand position 89,089,651 bp, CTTCTGAATGAGCCTTGGTT and ending after GGCTAGCCACGCCTCTGGACC at 89,089,391 bp (GRCm38/mm10). This mutation deletes exon 4 and 184 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 479 and early truncation 4 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|