Rmnd5bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rmnd5bem1(IMPC)J |
| Name: |
required for meiotic nuclear division 5 homolog B; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5755131 |
| Synonyms: |
Rmnd5bem1J |
| Gene: |
Rmnd5b Location: Chr11:51514500-51526723 bp, - strand Genetic Position: Chr11, 31.15 cM, cytoband B1.3
|
| Alliance: |
Rmnd5bem1(IMPC)J page
|
| IMPC: |
Rmnd5b gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Rmnd5b-7482J-F6151 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGTGTCCAGGGTCTAGGAG, CTAGTGTGTACTGGTTTGGC, ACATGTAGTAGGAAGCAGAC, and GTGTTTAACTCTGGCATGCA, which resulted in a 350 bp deletion spanning ENSMUSE00000293981 (exon 3) beginning at Chromosome 11 negative strand position 51,628,161 bp, GTGTTTAACTCTGGCATGCAG and ending after AGTGTGTACTGGTTTGGCAG at 51,627,812 bp (GRCm38/mm10). This mutation deletes exon 3 and 204 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause a change in amino acid sequence after residue 46 and early truncation 4 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|