About   Help   FAQ
Rmnd5bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rmnd5bem1(IMPC)J
Name: required for meiotic nuclear division 5 homolog B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755131
Synonyms: Rmnd5bem1J
Gene: Rmnd5b  Location: Chr11:51514500-51526723 bp, - strand  Genetic Position: Chr11, 31.15 cM, cytoband B1.3
Alliance: Rmnd5bem1(IMPC)J page
IMPC: Rmnd5b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rmnd5b-7482J-F6151 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAGTGTCCAGGGTCTAGGAG, CTAGTGTGTACTGGTTTGGC, ACATGTAGTAGGAAGCAGAC, and GTGTTTAACTCTGGCATGCA, which resulted in a 350 bp deletion spanning ENSMUSE00000293981 (exon 3) beginning at Chromosome 11 negative strand position 51,628,161 bp, GTGTTTAACTCTGGCATGCAG and ending after AGTGTGTACTGGTTTGGCAG at 51,627,812 bp (GRCm38/mm10). This mutation deletes exon 3 and 204 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause a change in amino acid sequence after residue 46 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rmnd5b Mutation:  38 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory