Pacrg^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pacrg^em1(IMPC)J
• Name: PARK2 co-regulated; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5755130
• Synonyms: Pacrg^em1J
• Gene: Pacrg Location: Chr17:10621938-11059078 bp, - strand Genetic Position: Chr17, 7.8 cM, cytoband A2
• Alliance: Pacrg^em1(IMPC)J page
• IMPC: Pacrg gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGGCGCTGCGAGACGCAGAC, TTTTTATAAATTGACTTACG, GTCAGTCACACCTATCTGAA, and AGTGTGCAGCAGGCTGTGTA, which resulted in a 417 bp deletion beginning at Chromosome 17 negative strand position 10,597,238 bp, TTTTTGATGGGCTTTCTGAA and ending after CAGACTCTAACTTGTCCATTC at 10,596,822 bp (GRCm38/mm10). This mutation deletes 130 bp of ENSMUSE00001269415 (exon 3) and 287 bp of downstream intronic sequence including the splice donor. This mutation is predicted to result in a change of amino acid sequence after residue 95 and early truncation 16 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pacrg Mutation: 41 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)