About   Help   FAQ
Pacrgem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pacrgem1(IMPC)J
Name: PARK2 co-regulated; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5755130
Synonyms: Pacrgem1J
Gene: Pacrg  Location: Chr17:10621938-11059078 bp, - strand  Genetic Position: Chr17, 7.8 cM, cytoband A2
Alliance: Pacrgem1(IMPC)J page
IMPC: Pacrg gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGGCGCTGCGAGACGCAGAC, TTTTTATAAATTGACTTACG, GTCAGTCACACCTATCTGAA, and AGTGTGCAGCAGGCTGTGTA, which resulted in a 417 bp deletion beginning at Chromosome 17 negative strand position 10,597,238 bp, TTTTTGATGGGCTTTCTGAA and ending after CAGACTCTAACTTGTCCATTC at 10,596,822 bp (GRCm38/mm10). This mutation deletes 130 bp of ENSMUSE00001269415 (exon 3) and 287 bp of downstream intronic sequence including the splice donor. This mutation is predicted to result in a change of amino acid sequence after residue 95 and early truncation 16 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pacrg Mutation:  41 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory