About   Help   FAQ
2700054A10Rikem2(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: 2700054A10Rikem2(IMPC)Mbp
Name: RIKEN cDNA 2700054A10 gene; endonuclease-mediated mutation 2, Mouse Biology Program, UC Davis
MGI ID: MGI:5755102
Gene: 2700054A10Rik  Location: Chr17:13707283-13774356 bp, - strand  Genetic Position: Chr17, 8.9 cM
Alliance: 2700054A10Rikem2(IMPC)Mbp page
IMPC: 2700054A10Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences ACACAGGAGGGCTAACATGA, CCTGTGGTCTTGGGTCACCA, GTGTGTGTGTATTTCCACAA, and TCAGAAAGGAGTCTTAACTG. This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any 2700054A10Rik Mutation:  1 strain or line available
References
Original:  J:157064 University of California, Davis, Alleles produced for the KOMP project by the University of California, Davis. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory