About   Help   FAQ
Trhem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Trhem1(IMPC)Tcp
Name: thyrotropin releasing hormone; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5755093
Gene: Trh  Location: Chr6:92219042-92221631 bp, - strand  Genetic Position: Chr6, 41.03 cM
Alliance: Trhem1(IMPC)Tcp page
IMPC: Trh gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0430 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences TCAAGAATCGACGTTCTGGC, CAGATGCCCCCCAAGTCAAG, GCTTTGATCTTCGTGCTAAC, and GGATCTATGAACCTCCGGCC. This resulted in a 1,034-bp deletion from Chr6:92242806 to 92243839 (GRCm38) in exons ENSMUSE00000194388 and ENSMUSE00000414256, p.(F14*). (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Trh Mutation:  22 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/16/2024
MGI 6.23
The Jackson Laboratory