Tmem160em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tmem160em1(IMPC)Tcp |
| Name: |
transmembrane protein 160; endonuclease-mediated mutation 1, The Centre for Phenogenomics |
| MGI ID: |
MGI:5755091 |
| Gene: |
Tmem160 Location: Chr7:16186867-16189415 bp, + strand Genetic Position: Chr7, 9.13 cM, cytoband A2
|
| Alliance: |
Tmem160em1(IMPC)Tcp page
|
| IMPC: |
Tmem160 gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele, from project TCPR0363, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences AGTGTCCGAGCTGGATCGCG and ACTTCTGTCATCCGGCATTG. This resulted in a 1,033 bp deletion from Chr7:16453129 to 16454161 and 16 bp deletion from Chr7:16454205 to 16454221, from within exons ENSMUSE00000384664 and ENSMUSE00000198013, removing the splice donor site from the distal exon. This mutation is predicted to cause a frameshift with amino acid changes after residue 57 and early truncation 5 amino acids later (p.R57Wfs*7) (GRCm38).
(J:165963)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010; |
| All: |
4 reference(s) |
|