About   Help   FAQ
Spxem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Spxem1(IMPC)Tcp
Name: spexin hormone; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5755088
Gene: Spx  Location: Chr6:142359167-142365456 bp, + strand  Genetic Position: Chr6, 74.03 cM
Alliance: Spxem1(IMPC)Tcp page
IMPC: Spx gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0399 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences CAGCCTCATCGGACGGAGTG, TTGGTCGATGTGTCTTGTAG, ACTCCTTATTCTCCTCACGG, and GCCGGCTCCAGTAAATAATT. This resulted in a 289 bp deletion from Chr6:142413819 to 142414107 & 31 bp deletion from Chr6:142414151 to 142414181, encompassing ENSMUSE00000608439 & ENSMUSE00000608438. This mutation is predicted to cause a frameshift with amino acid changes after residue 3 and early truncation 27 amino acids later (p.G3Rfs*29). (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Spx Mutation:  15 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory