About   Help   FAQ
Slc23a3em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc23a3em1(IMPC)Tcp
Name: solute carrier family 23 (nucleobase transporters), member 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5755087
Gene: Slc23a3  Location: Chr1:75102185-75110534 bp, - strand  Genetic Position: Chr1, 38.6 cM, cytoband C3
Alliance: Slc23a3em1(IMPC)Tcp page
IMPC: Slc23a3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele, from project TCPR0311, was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and four guide RNAs with spacer sequences CAGCGAGACTGAATAAATTA, GTCACGTGGTATGATACCTC, GGACTGTCGGGAGTAATCAA, and GTTTAGATTATCAGGCCCTG. This resulted in a 1154 bp-deletion from Chr1:75131276 to 75132429 in OTTMUSE00000662432 & OTTMUSE00000662425 (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc23a3 Mutation:  26 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory