Ptp4a1^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ptp4a1^em2(IMPC)Tcp
• Name: protein tyrosine phosphatase 4a1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:5755068
• Gene: Ptp4a1 Location: Chr1:30979384-30988838 bp, - strand Genetic Position: Chr1, 11.47 cM
• Alliance: Ptp4a1^em2(IMPC)Tcp page
• IMPC: Ptp4a1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences AGTCCTGTCCTGCATGCAGG and ATGCTACGTGTTATGTTGGG that targeted exon(s) ENSMUSE00000155460.2 ENSMUSE00001302830.2 ENSMUSE00001448270.2 ENSMUSE00001448561.2 ENSMUSE00001449430.2 ENSMUSE00001450307.2. This resulted in deletion(s) of 915 bp (location: Chr1:30983370-30984284; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

10 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ptp4a1 Mutation: 15 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)