About   Help   FAQ
Polr3aem2(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Polr3aem2(IMPC)Tcp
Name: polymerase (RNA) III (DNA directed) polypeptide A; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID: MGI:5755039
Gene: Polr3a  Location: Chr14:24498764-24537126 bp, - strand  Genetic Position: Chr14, 14.4 cM
Alliance: Polr3aem2(IMPC)Tcp page
IMPC: Polr3a gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Insertion
 
Mutation detailsThis allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA, the guide sequence CCGGCATTTATCTGAGATCTTCT, and a donor oligo, which resulted in a 1 bp insertion at Chr14:24482833_insT in ENSMUSE00000514690. This mutation is predicted to cause a frameshift with amino acid changes after residue 149 (p.K149*). (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Polr3a Mutation:  70 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory