Poc5^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Poc5^em1(IMPC)Tcp
• Name: POC5 centriolar protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5755027
• Gene: Poc5 Location: Chr13:96524767-96553719 bp, + strand Genetic Position: Chr13, 50.56 cM
• Alliance: Poc5^em1(IMPC)Tcp page
• IMPC: Poc5 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR0359 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences TCGGGCTTATTGCCTTGAAG and TTCCCGGCTCTTTTGACGGT. This resulted in a 614 bp deletion and 174 bp insertion from Chr13:96392926 to 96393539, exon ENSMUSE00000119907. (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Poc5 Mutation: 28 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)