About   Help   FAQ
Nhsem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Nhsem1(IMPC)Tcp
Name: NHS actin remodeling regulator; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754996
Gene: Nhs  Location: ChrX:160616286-160942437 bp, - strand  Genetic Position: ChrX, 74.17 cM
Alliance: Nhsem1(IMPC)Tcp page
IMPC: Nhs gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0257 at TCP by injecting Cas9 mRNA and two guide RNAs with the spacer sequences ACATCTTCCTCCCAGCGACC and CTTGCTCTCGATGTCCAAGT. This resulted in a 77 bp deletion from ChrX:161875305 to 161875381 in ENSMUSE00000470130. This mutation is predicted to cause a frameshift with amino acid changes after residue 190 and early truncation 19 amino acids later (p.L190Qfs*21). (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Nhs Mutation:  19 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory