About   Help   FAQ
Gm4922em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Gm4922em1(IMPC)Tcp
Name: predicted gene 4922; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754602
Gene: Gm4922  Location: Chr10:18655475-18662541 bp, - strand  Genetic Position: Chr10, 7.92 cM
Alliance: Gm4922em1(IMPC)Tcp page
IMPC: Gm4922 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele produced from project TCPR0417 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences GTGAGCTCGGTCTTGGTTTG, CTTCAGGACGGTGTACTGCC, CAGCTCAGTGTCCTAATCAC, and ATGTCCGTTTGGCAGAATAG. This resulted in a 5-bp deletion from Chr10:18785183 to 18785187, a 1,713-bp deletion from Chr10:18783181 to 18784893 deleting majority of ENSMUSE00000403934 including splice donor (single exon ORF) & 6-bp deletion from Chr10:18783159 to 18783164 (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gm4922 Mutation:  29 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory