Prag1^em2(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prag1^em2(IMPC)Tcp
• Name: PEAK1 related kinase activating pseudokinase 1; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:5754594
• Gene: Prag1 Location: Chr8:36561982-36614941 bp, + strand Genetic Position: Chr8, 22.78 cM
• Alliance: Prag1^em2(IMPC)Tcp page
• IMPC: Prag1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele produced from project TCPR0367 at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with the spacer sequences GTTTACCTAGGCAGCTTCCG and ATGCAGTCCGACCATGGTAT. This resulted in a 71-bp deletion from Chr8:36102633 to 36102703 insT (GRCm38). (J:165963)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prag1 Mutation: 62 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 4 reference(s)