About   Help   FAQ
Adarb2em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Adarb2em1(IMPC)Tcp
Name: adenosine deaminase, RNA-specific, B2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754576
Gene: Adarb2  Location: Chr13:8252902-8818783 bp, + strand  Genetic Position: Chr13, 3.48 cM, cytoband A1
Alliance: Adarb2em1(IMPC)Tcp page
IMPC: Adarb2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele, from project TCPR0409, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences GGGGAGGTCCTCCGTCATCC, TCAGCACTTCAGGCCAGGTC, GTGAGTTGGGATATTCTTGC, and GGCCTGCTGCTCTCCCCGTG. This resulted in an indel at Chr13:8569440 del T insCCTCCTCTGA; a 1140-bp deletion on Chr13 from 8569541 to 8570680; and an indel at Chr13:85670687 insT (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Adarb2 Mutation:  60 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory