Adarb2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adarb2^em1(IMPC)Tcp
• Name: adenosine deaminase, RNA-specific, B2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754576
• Gene: Adarb2 Location: Chr13:8252902-8818783 bp, + strand Genetic Position: Chr13, 3.48 cM, cytoband A1
• Alliance: Adarb2^em1(IMPC)Tcp page
• IMPC: Adarb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0409, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences GGGGAGGTCCTCCGTCATCC, TCAGCACTTCAGGCCAGGTC, GTGAGTTGGGATATTCTTGC, and GGCCTGCTGCTCTCCCCGTG. This resulted in an indel at Chr13:8569440 del T insCCTCCTCTGA; a 1140-bp deletion on Chr13 from 8569541 to 8570680; and an indel at Chr13:85670687 insT (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Adarb2 Mutation: 58 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)