Itm2c^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Itm2c^em1Tcp
• Name: integral membrane protein 2C; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754569
• Gene: Itm2c Location: Chr1:85822231-85836419 bp, + strand Genetic Position: Chr1, 43.94 cM
• Alliance: Itm2c^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA and the guide sequence CCTCGCCACCGCTCCCGGAAAGG, which resulted in a Indel. (J:165963)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Itm2c Mutation: 17 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 2 reference(s)