About   Help   FAQ
Itm2cem1Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Itm2cem1Tcp
Name: integral membrane protein 2C; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754569
Gene: Itm2c  Location: Chr1:85822231-85836419 bp, + strand  Genetic Position: Chr1, 43.94 cM
Alliance: Itm2cem1Tcp page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Toronto Centre for Phenogenomics by injecting CAS9 RNA and the guide sequence CCTCGCCACCGCTCCCGGAAAGG, which resulted in a Indel. (J:165963)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Itm2c Mutation:  17 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory