About   Help   FAQ
Mpzem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Mpzem1(IMPC)Tcp
Name: myelin protein zero; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754548
Gene: Mpz  Location: Chr1:170978282-170988699 bp, + strand  Genetic Position: Chr1, 79.05 cM
Alliance: Mpzem1(IMPC)Tcp page
IMPC: Mpz gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project TCPR0238 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and one guide RNA with the spacer sequence TCTTGCCCACTATGTCCGGT and an oligonucleotide repair template. Non-homologous end-joining repair resulted in a 19 bp deletion from Chr1:171158916 to 171158934 in ENSMUSE00000476648. This mutation is predicted to cause a frameshift with amino acid changes after residue 134 and early truncation 20 amino acids later (p.D134Lfs*22). The repair template was not integrated. (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mpz Mutation:  28 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory