About   Help   FAQ
Ofcc1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ofcc1em1(IMPC)J
Name: orofacial cleft 1 candidate 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5752778
Synonyms: Ofcc1em1J
Gene: Ofcc1  Location: Chr13:40155358-40514926 bp, - strand  Genetic Position: Chr13, 19.45 cM
Alliance: Ofcc1em1(IMPC)J page
IMPC: Ofcc1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ofcc1- 7447J-M8483 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGCCTGACCAAATCCATG, GCAACGCCAGTGAACATGTA, TCTTTCTTATATGGAATAAG, and AGTCAATGTTAAAACAATGA, which resulted in a 435 bp deletion spanning exon 5 beginning at Chromosome 13 negative strand position 40,255,271 bp, TTATTCCATATAAGAAAGAAA and ending after TCCTATCTTTCCACATGGAT at 40,255,271 bp (GRCm38/mm10). This mutation deletes exon 5 and 268 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause amino acid sequence change after residue 114 and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ofcc1 Mutation:  75 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory