About   Help   FAQ
Pcnx2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcnx2em1(IMPC)J
Name: pecanex homolog 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5752758
Synonyms: Pcnx2em1J
Gene: Pcnx2  Location: Chr8:126478247-126625056 bp, - strand  Genetic Position: Chr8, 73.65 cM
Alliance: Pcnx2em1(IMPC)J page
IMPC: Pcnx2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Pcnxl2-7417J-M4954 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAATGTTTCTGTCTGCGGTG, TTGTAACTAAGAGCTCTTTT, CTTAGAGGTTTAAAGCGAAG, and TCTTTACTGAGCACAAGTCA, which resulted in a 476 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 125,891,793 bp, TTTTGGGAGCTGGCACTCTCCT and ending after ATCAGTCACTTTGATGACCAA at 125,892,268 bp (GRCm38/mm10). This mutation deletes exon 2 and 270 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after residue 51 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pcnx2 Mutation:  130 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory