Pcnx2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pcnx2^em1(IMPC)J
• Name: pecanex homolog 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5752758
• Synonyms: Pcnx2^em1J
• Gene: Pcnx2 Location: Chr8:126478247-126625056 bp, - strand Genetic Position: Chr8, 73.65 cM
• Alliance: Pcnx2^em1(IMPC)J page
• IMPC: Pcnx2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Pcnxl2-7417J-M4954 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAATGTTTCTGTCTGCGGTG, TTGTAACTAAGAGCTCTTTT, CTTAGAGGTTTAAAGCGAAG, and TCTTTACTGAGCACAAGTCA, which resulted in a 476 bp deletion spanning exon 2 beginning at Chromosome 8 positive strand position 125,891,793 bp, TTTTGGGAGCTGGCACTCTCCT and ending after ATCAGTCACTTTGATGACCAA at 125,892,268 bp (GRCm38/mm10). This mutation deletes exon 2 and 270 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after residue 51 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pcnx2 Mutation: 130 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)