About   Help   FAQ
Mpv17em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mpv17em1(IMPC)J
Name: MpV17 mitochondrial inner membrane protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5750696
Synonyms: Mpv17em1J
Gene: Mpv17  Location: Chr5:31298007-31311595 bp, - strand  Genetic Position: Chr5, 17.12 cM
Alliance: Mpv17em1(IMPC)J page
IMPC: Mpv17 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Mpv17-7397J-F2271 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCTAGGTAGGAAAGGCCAA, CGTTGGTTTCTGTTCCTGGA, GCTTGGCACTCCGAGTTCTA, and TCAGCAGATTTTCCTTTTAG, which resulted in a 212 bp deletion spanning exon 3 beginning at Chromosome 5 negative strand position 31,146,130 bp, CTTTTAGGGGATGTCCTGAC, and ending after TGGCTTTTCCATTGGCCTTTC at 31,145,919 bp (GRCm38/mm10). This mutation deletes exon 3 and 96 bp of intronic sequence including the splice acceptor and donor, and there is another small 22 bp deletion in the intron that will not affect the exon deletion. This mutation is predicted to cause an amino acid change after 24 residues and early truncation 65 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Mpv17 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory