Mpv17^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mpv17^em1(IMPC)J
• Name: MpV17 mitochondrial inner membrane protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5750696
• Synonyms: Mpv17^em1J
• Gene: Mpv17 Location: Chr5:31298007-31311595 bp, - strand Genetic Position: Chr5, 17.12 cM
• Alliance: Mpv17^em1(IMPC)J page
• IMPC: Mpv17 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Mpv17-7397J-F2271 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCTAGGTAGGAAAGGCCAA, CGTTGGTTTCTGTTCCTGGA, GCTTGGCACTCCGAGTTCTA, and TCAGCAGATTTTCCTTTTAG, which resulted in a 212 bp deletion spanning exon 3 beginning at Chromosome 5 negative strand position 31,146,130 bp, CTTTTAGGGGATGTCCTGAC, and ending after TGGCTTTTCCATTGGCCTTTC at 31,145,919 bp (GRCm38/mm10). This mutation deletes exon 3 and 96 bp of intronic sequence including the splice acceptor and donor, and there is another small 22 bp deletion in the intron that will not affect the exon deletion. This mutation is predicted to cause an amino acid change after 24 residues and early truncation 65 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mpv17 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)