About   Help   FAQ
Tbc1d5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tbc1d5em1(IMPC)J
Name: TBC1 domain family, member 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5750182
Synonyms: Tbc1d5em1J
Gene: Tbc1d5  Location: Chr17:51040152-51486380 bp, - strand  Genetic Position: Chr17, 26.47 cM
Alliance: Tbc1d5em1(IMPC)J page
IMPC: Tbc1d5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Tbc1d5-7380J-M1353 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTTCAGTGATCCCTGTGT, TAGGAAAGGAACCAGATCAG, AGCACTCCTCTTGTAGTAGA, and CCTGGAAGATTACCCACACA, which resulted in a 231 bp deletion spanning exon 5 beginning at Chromosome 17 negative strand position 50,968,324 bp, CCCCTGATCTGGTTCCTTTCC, and ending after CCACACAGGGATCACTGAAA at 50,968,094 bp (GRCm38/mm10). This mutation deletes exon 5 and 112 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after 55 residues and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tbc1d5 Mutation:  59 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory