About   Help   FAQ
Hsbp1l1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Hsbp1l1em1(IMPC)J
Name: heat shock factor binding protein 1-like 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5750173
Synonyms: Hsbp1l1em1J
Gene: Hsbp1l1  Location: Chr18:80272973-80290317 bp, - strand  Genetic Position: Chr18, 53.35 cM
Alliance: Hsbp1l1em1(IMPC)J page
IMPC: Hsbp1l1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Hsbp1l1-7411J-M303 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTCTCCCAGGATTTACAT, TTAGGGTGTTCGGTAAGAAG, GACATTGTAAATACATACCG and TATTTGTTTAGGTTAGTCCA, which resulted in a 169 bp deletion spanning exon 3 beginning at Chromosome 18 negative strand position 80,235,598 bp, GTCCACGGTATGTATTTAC, and ending after AATATCCTTTCCTCTTCTTA at 80,235,430 bp (GRCm38/mm10). This mutation deletes exon 3 and 102 bp of intronic sequence including the splice acceptor and donor. There is an additional 22 bp deletion in intron 4, which will not affect the exon deletion. This mutation is predicted to cause a change in amino acid sequence after 17 residues and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Hsbp1l1 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory