Tardbp^em1H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tardbp^em1H
• Name: TAR DNA binding protein; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:5749956
• Synonyms: TDP-43 Q331K
• Gene: Tardbp Location: Chr4:148696839-148711476 bp, - strand Genetic Position: Chr4, 78.77 cM
• Alliance: Tardbp^em1H page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Single point mutation
• Mutation details: This allele was generated at Medical Research Council Harwell using D10A and guides with spacer sequences CTCCACCCATATTACCACCC and GGCAGCGTTGCAGAGCAGTT that targeted exon(s) ENSMUSE00000523896.4. This resulted in deletion(s) of 8 bp (location: Chr4:148702969-148702976; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tardbp Mutation: 88 strains or lines available

References

• Original: J:265666 Fratta P, et al., Mice with endogenous TDP-43 mutations exhibit gain of splicing function and characteristics of amyotrophic lateral sclerosis. EMBO J. 2018 Jun 1;37(11)
• All: 2 reference(s)