Plcz1^em2(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plcz1^em2(IMPC)H
• Name: phospholipase C, zeta 1; endonuclease-mediated mutation 2, Harwell
• MGI ID: MGI:5749951
• Gene: Plcz1 Location: Chr6:139935399-139987183 bp, - strand Genetic Position: Chr6, 69.77 cM, cytoband G1
• Alliance: Plcz1^em2(IMPC)H page
• IMPC: Plcz1 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence TACTCTGGTGATGAATGCCGCGG, and a donor oligo, which resulted in a Indel. (J:237616)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Plcz1 Mutation: 56 strains or lines available

References

• Original: J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013
• All: 2 reference(s)