About   Help   FAQ
Plcz1em2(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Plcz1em2(IMPC)H
Name: phospholipase C, zeta 1; endonuclease-mediated mutation 2, Harwell
MGI ID: MGI:5749951
Gene: Plcz1  Location: Chr6:139935399-139987183 bp, - strand  Genetic Position: Chr6, 69.77 cM, cytoband G1
Alliance: Plcz1em2(IMPC)H page
IMPC: Plcz1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence TACTCTGGTGATGAATGCCGCGG, and a donor oligo, which resulted in a Indel. (J:237616)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Plcz1 Mutation:  56 strains or lines available
References
Original:  J:90559 The Mammalian Genetics Unit at Harwell, Information obtained from the Mammalian Genetics Unit, Medical Research Council (MRC), Harwell, UK. Unpublished. 2004-2013;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory