Ndufs8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ndufs8^em1(IMPC)J
• Name: NADH:ubiquinone oxidoreductase core subunit S8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5749812
• Synonyms: Ndufs8^-, Ndufs8^em1J
• Gene: Ndufs8 Location: Chr19:3958863-3962774 bp, - strand Genetic Position: Chr19, 3.63 cM
• Alliance: Ndufs8^em1(IMPC)J page
• IMPC: Ndufs8 gene page

Ndufs8^em1(IMPC)J/Ndufs8^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CTACCTTGATACACTCCCCC, GAGAGTCAGGCGTGGACGGC, TCAGGCGTGGACGGCCGGAG, and TTTAGGGCCTAGTAGTTAGA that targeted exon(s) ENSMUSE00000501001.2. This resulted in deletion(s) of 114 bp (location: Chr19:3961003-3961116; GRCm39), 168 bp (location: Chr19:3960832-3960999; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ndufs8 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)