Ndufs8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ndufs8^em1(IMPC)J
• Name: NADH:ubiquinone oxidoreductase core subunit S8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5749812
• Synonyms: Ndufs8^-, Ndufs8^em1J
• Gene: Ndufs8 Location: Chr19:3958863-3962774 bp, - strand Genetic Position: Chr19, 3.63 cM
• Alliance: Ndufs8^em1(IMPC)J page
• IMPC: Ndufs8 gene page

Ndufs8^em1(IMPC)J/Ndufs8^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ndufs8-7413J-M338 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, CTACCTTGATACACTCCCCC, TTTAGGGCCTAGTAGTTAGA, TCAGGCGTGGACGGCCGGAG and GAGAGTCAGGCGTGGACGGC, which resulted in a 282 bp deletion spanning exon 5 beginning at Chromosome 19 negative strand position 3,911,117 bp, CGGCCGGAGAGGAGAGCATCC, and ending after CCCTACCTTGATACACTCC at 3,910,836 bp (GRCm38/mm10). This mutation deletes exon 5 and 109 bp of intronic sequence including the splice acceptor and donor. It is predicted to result in a change in amino acid sequence after residue 69 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ndufs8 Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)