About   Help   FAQ
Ndufs8em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ndufs8em1(IMPC)J
Name: NADH:ubiquinone oxidoreductase core subunit S8; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5749812
Synonyms: Ndufs8-, Ndufs8em1J
Gene: Ndufs8  Location: Chr19:3958863-3962774 bp, - strand  Genetic Position: Chr19, 3.63 cM
Alliance: Ndufs8em1(IMPC)J page
IMPC: Ndufs8 gene page
Ndufs8em1(IMPC)J/Ndufs8em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or hallmarks of gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ndufs8-7413J-M338 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, CTACCTTGATACACTCCCCC, TTTAGGGCCTAGTAGTTAGA, TCAGGCGTGGACGGCCGGAG and GAGAGTCAGGCGTGGACGGC, which resulted in a 282 bp deletion spanning exon 5 beginning at Chromosome 19 negative strand position 3,911,117 bp, CGGCCGGAGAGGAGAGCATCC, and ending after CCCTACCTTGATACACTCC at 3,910,836 bp (GRCm38/mm10). This mutation deletes exon 5 and 109 bp of intronic sequence including the splice acceptor and donor. It is predicted to result in a change in amino acid sequence after residue 69 and early truncation 3 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ndufs8 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory