About   Help   FAQ
Dgkhem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dgkhem1(IMPC)J
Name: diacylglycerol kinase, eta; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5749809
Synonyms: Dgkhem1J
Gene: Dgkh  Location: Chr14:78796789-78970169 bp, - strand  Genetic Position: Chr14, 41.56 cM
Alliance: Dgkhem1(IMPC)J page
IMPC: Dgkh gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Dgkh-7399J-M2307 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAAGATGCAAGTTTTGGCC, GTACATAGATACCTTATCTC, GCTTCGGTGTTCACAGTAAC, and CGAAGACAACGTTCAGTCAG, which resulted in a 295 bp deletion spanning exon 5 beginning at Chromosome 14 positive strand position 78,627,550 bp, GCCAAAACTTGCATCTTAATT, and ending after AAGACAACGTTCAGTCAGAG at 78,627,844 bp (GRCm38/mm10). There is also a 6bp (ctgtta) insertion in the intron that will not affect the exon deletion. This mutation deletes exon 5 and 164 bp of intronic sequence including the splice acceptor and donor. This mutation causes amino acid sequence change after residue 160 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Dgkh Mutation:  55 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory