Hpse2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Hpse2em1(IMPC)J |
| Name: |
heparanase 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5749801 |
| Synonyms: |
Hpse2em1J |
| Gene: |
Hpse2 Location: Chr19:42774978-43376794 bp, - strand Genetic Position: Chr19, 36.57 cM
|
| Alliance: |
Hpse2em1(IMPC)J page
|
| IMPC: |
Hpse2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Hpse2-7398J-F2290 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTCCTCCAACACTCAAAAT, GTCCCGATTTTGAGTGTTGG, GTGCTCTCTAGCCTTCTCCC, and TAGATAATAAATCTCCCACC, which resulted in a 285 bp deletion spanning exon 2 beginning at Chromosome 19 negative strand position 43,385,002 bp, CCCACCAGGTCTCCTGCAGG and ending after AGAAATTTGGTCCCGATTTT at 43,384,718 bp (GRCm38/mm10). This mutation deletes exon 2 and 127 bp of intronic sequence including the splice acceptor and donor. This mutation is expected to cause an amino acid sequence change after 96 amino acids and early truncation 4 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|