About   Help   FAQ
Cdin1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdin1em1(IMPC)J
Name: CDAN1 interacting nuclease 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5749789
Synonyms: BC052040em1J, Cdin1-
Gene: Cdin1  Location: Chr2:115412197-115609249 bp, + strand  Genetic Position: Chr2, 58.18 cM
Alliance: Cdin1em1(IMPC)J page
IMPC: Cdin1 gene page
Cdin1em1(IMPC)J/Cdin1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form typical outgrowth colonies.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project BC052040-7395J-M2241 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGAAACATGTGCACACAG, GGTCATGCAGTGACAAGGAA, CTACTCTAGATAGGCCCCTT, and TAAACCTGAGCTAAACCTAA, which resulted in a 195 bp deletion spanning exon 4 beginning at Chromosome 2 positive strand position 115,638,917 bp, GGAGAAACATGTGCACACAGG, and ending after AACCTGAGCTAAACCTAAGG at 115,639,111 bp (GRCm38/mm10). This mutation deletes exon 4 and 134 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 71 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cdin1 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory