Cdin1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Cdin1em1(IMPC)J |
| Name: |
CDAN1 interacting nuclease 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5749789 |
| Synonyms: |
BC052040em1J, Cdin1- |
| Gene: |
Cdin1 Location: Chr2:115412197-115609249 bp, + strand Genetic Position: Chr2, 58.18 cM
|
| Alliance: |
Cdin1em1(IMPC)J page
|
| IMPC: |
Cdin1 gene page |
|
Cdin1em1(IMPC)J/Cdin1em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts hatch from the zona pellucida and form typical outgrowth colonies.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project BC052040-7395J-M2241 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGAAACATGTGCACACAG, GGTCATGCAGTGACAAGGAA, CTACTCTAGATAGGCCCCTT, and TAAACCTGAGCTAAACCTAA, which resulted in a 195 bp deletion spanning exon 4 beginning at Chromosome 2 positive strand position 115,638,917 bp, GGAGAAACATGTGCACACAGG, and ending after AACCTGAGCTAAACCTAAGG at 115,639,111 bp (GRCm38/mm10). This mutation deletes exon 4 and 134 bp of intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid change after residue 71 and early truncation 6 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|