About   Help   FAQ
Loxl1em2J
Endonuclease-mediated Allele Detail
Summary
Symbol: Loxl1em2J
Name: lysyl oxidase-like 1; endonuclease-mediated mutation 2, Jackson
MGI ID: MGI:5706768
Gene: Loxl1  Location: Chr9:58195021-58220469 bp, - strand  Genetic Position: Chr9, 31.65 cM
Alliance: Loxl1em2J page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready)
Mutation:    Insertion
 
Mutation detailsThis loxP flanked allele from project Loxl1-6513J-101P2M(2R)was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, GAATGGCATGCCACAAGTAA and TCAGATACTTTGCCAGACTC, along with a plasmid containing 2618 bp of Loxl1 sequence comprised of 1 kb 5-prime and 3-prime homology arms with two 60 bp-cassettes flanking exon 2 that contain a loxP site, HindIII cut site, and an additional unique 20 bp sequence as a sequencing primer. This allele shows a complete integration of the Loxl1 2618 bp sequence by homologous recombination beginning in Chromosome 9 negative strand position 58,298,994 bp CATGACTCAAGCACCCCATCTTTAC, and ending after GGACTATCTTAAGTGCCCAGC at 58,296,497 bp (GRCm38), resulting in a loxP flanked exon 2. It is predicted that mating this strain with cre will generate a deletion of exon 2 causing a change of amino acid sequence after amino acid 400 and early truncation 22 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Loxl1 Mutation:  37 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory