Engaseem2Lutzy
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Engaseem2Lutzy |
| Name: |
endo-beta-N-acetylglucosaminidase; endonuclease-mediated mutation 2, Cathy Lutz |
| MGI ID: |
MGI:5700326 |
| Synonyms: |
Engaseem2(4del)Lutzy |
| Gene: |
Engase Location: Chr11:118367655-118380035 bp, + strand Genetic Position: Chr11, 83.21 cM
|
| Alliance: |
Engaseem2Lutzy page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: The allele was generated by injecting Cas9 RNA and guide sequences homologous to Engase exon 3 (GTGGAGGCCGGCGACACACC and GGAGGCCGGCGACACACCAG). The CRISPR/cas9 endonuclease mediated genome editing introduced a 4 nt (gtgt) deletion within exon 3. The mutant generated contains a discrete 4 nt GTGT deletion in exon 3 within the Engase open reading frame causing a frameshift beginning at Val 104 and leading to translation termination 18 amino acids later. The mutant mouse is predicted to express a 121 amino acid 13.5 kDa polypeptide from the Engase gene.
(J:101977)
|
|
|
|
|
| Original: |
J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017; |
| All: |
1 reference(s) |
|