About   Help   FAQ
Kcnc3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnc3em1(IMPC)J
Name: potassium voltage gated channel, Shaw-related subfamily, member 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5697086
Synonyms: Kcnc3em1J
Gene: Kcnc3  Location: Chr7:44240088-44254178 bp, + strand  Genetic Position: Chr7, 28.85 cM
Alliance: Kcnc3em1(IMPC)J page
IMPC: Kcnc3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Kcnc3-7063J-F4895 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GCTTCTAAAGAACTTGGTGG, CTACTATGCCGAACGCATCG, and AGAGGTGATTGAAACCAACA, which resulted in a 1182 bp deletion in exon 2 beginning at Chromosome 7 positive strand position 44,595,080 bp, GTGAGGCCACCACCAAGTTCTTTAG, and ending after CAAGAAGAGGTGATTGAAACCAACA at 44,596,261 bp (GRCm38/mm10). This mutation deletes most of exon 2, except for the last 7 bp, and deletes the splice acceptor. It is predicted to result in a change in amino acid sequence after 291 amino acid residues and early truncation 71 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Kcnc3 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory