Rxfp3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rxfp3^em1(IMPC)J
• Name: relaxin family peptide receptor 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5697049
• Synonyms: Rxfp3^em1J
• Gene: Rxfp3 Location: Chr15:11033803-11038054 bp, - strand Genetic Position: Chr15, 5.42 cM
• Alliance: Rxfp3^em1(IMPC)J page
• IMPC: Rxfp3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rxfp3-6943J-F9508 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GGTGGCTTCTGCAACCCCCG, with a non-contributing plasmid, which resulted in a 20 bp deletion (TGCAGGTGGCTTCTGCAACC) in exon 1 beginning at Chromosome 15 positive strand position 11,037,264 bp (GRCm38/mm10). The 20 bp deletion alters the coding sequence such that the first 11 amino acids are changed followed by a stop codon, and is therefore predicted to be a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rxfp3 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)