About   Help   FAQ
Gpr15em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpr15em1(IMPC)J
Name: G protein-coupled receptor 15; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5697047
Synonyms: Gpr15em1J
Gene: Gpr15  Location: Chr16:58537796-58539433 bp, - strand  Genetic Position: Chr16, 34.83 cM
Alliance: Gpr15em1(IMPC)J page
IMPC: Gpr15 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gpr15-6923J-M9817 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ATACAACTGTGTAAAAGATA, with a non-contributing plasmid, which resulted in an 8 bp deletion (CTCCCTAT) in exon 1 beginning at Chromosome 16 negative strand position 58,718,619bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 36 and early truncation 39 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gpr15 Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory