About   Help   FAQ
Cldn13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cldn13em1(IMPC)J
Name: claudin 13; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5697043
Synonyms: Cldn13em1J
Gene: Cldn13  Location: Chr5:134943103-134944380 bp, - strand  Genetic Position: Chr5, 74.88 cM
Alliance: Cldn13em1(IMPC)J page
IMPC: Cldn13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Single point mutation
 
Mutation detailsThis allele from project Cldn13-6968J-M3024 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CATGGTCGTCAGCAAACAAG, along with a non-contributing plasmid, which resulted in a 1 bp insertion (G) in exon 1 beginning at Chromosome 5 negative strand position 134,915,313 bp (GRCm38/mm10). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 31 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cldn13 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory