About   Help   FAQ
Vwa5aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Vwa5aem1(IMPC)J
Name: von Willebrand factor A domain containing 5A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5696234
Synonyms: Vwa5aem1J
Gene: Vwa5a  Location: Chr9:38629564-38654633 bp, + strand  Genetic Position: Chr9, 20.89 cM, cytoband B
Alliance: Vwa5aem1(IMPC)J page
IMPC: Vwa5a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Vwa5a- 7101J M#8480 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CCAGAACTACTCCTCATCTA, GGCGACCTTTGTGTTTCCTA, TGGGCACATAGTAATTAAAA, which resulted in a 376 bp deletion in intron 3 beginning at Chromosome 9 positive strand position 38,722,488 bp, CTATGGGTGTTACTCTAGAAAAGC, and ending after GTTCTTTTATTCATTCCCTTT at 38,722,863 bp (GRCm38/mm10) in intron 4. This mutation deletes exon 3 and is predicted to result in amino acid sequence change after residue 14 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Vwa5a Mutation:  42 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory