Zfp641^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp641^em1(IMPC)J
• Name: zinc finger protein 641; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5689903
• Synonyms: Zfp641^em1J
• Gene: Zfp641 Location: Chr15:98183466-98194042 bp, - strand Genetic Position: Chr15, 54.29 cM
• Alliance: Zfp641^em1(IMPC)J page
• IMPC: Zfp641 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp641-7067J-M4958 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ACGGGAACTAACAAGCCAGT, GCAGCCGCACTTCTTGCAGC, and AAGTGCATCCTGGGAAAGAT, which resulted in a 214 bp deletion beginning in intron 3 at Chromosome 15 negative strand position 98,293,024 bp, GAAAGATGGGTAGTTCATC, and ending after CTTTGGCATCATCCCACTGG at 98,292,811 bp(GRCm38/mm10) in intron 4. The 214 bp mutation deletes all of exon 3 and is predicted to result in a change of amino acid sequence after amino acid 61 and early truncation 64 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp641 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)