Seboxem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Seboxem1(IMPC)J |
| Name: |
SEBOX homeobox; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5689890 |
| Synonyms: |
Seboxem1J |
| Gene: |
Sebox Location: Chr11:78394328-78395907 bp, + strand Genetic Position: Chr11, 46.74 cM
|
| Alliance: |
Seboxem1(IMPC)J page
|
| IMPC: |
Sebox gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Sebox-7066J-M4984 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ATCAAGGCTTTGGGGCTGGG, CAACTGCCCGACACTGAAAG, TCTGTCCCACAAGGCTGTGC, which resulted in a 304 bp deletion beginning in intron 2 at Chromosome 11 positive strand position 78,503,682bp, GGGCTGGGTGGAGGCTCTTGC, and ending after TTTCTGTCCCACAAGGCTGTG at 78,503,985bp(GRCm38/mm10) in intron 3. The 304 bp mutation deletes all of exon 2 and is predicted to cause a change in amino acid sequence after amino acid residue 10 and early truncation 80 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|