About   Help   FAQ
Seboxem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Seboxem1(IMPC)J
Name: SEBOX homeobox; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5689890
Synonyms: Seboxem1J
Gene: Sebox  Location: Chr11:78394328-78395907 bp, + strand  Genetic Position: Chr11, 46.74 cM
Alliance: Seboxem1(IMPC)J page
IMPC: Sebox gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Sebox-7066J-M4984 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, ATCAAGGCTTTGGGGCTGGG, CAACTGCCCGACACTGAAAG, TCTGTCCCACAAGGCTGTGC, which resulted in a 304 bp deletion beginning in intron 2 at Chromosome 11 positive strand position 78,503,682bp, GGGCTGGGTGGAGGCTCTTGC, and ending after TTTCTGTCCCACAAGGCTGTG at 78,503,985bp(GRCm38/mm10) in intron 3. The 304 bp mutation deletes all of exon 2 and is predicted to cause a change in amino acid sequence after amino acid residue 10 and early truncation 80 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sebox Mutation:  10 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory