Slc6a20bem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Slc6a20bem1(IMPC)J |
| Name: |
solute carrier family 6 (neurotransmitter transporter), member 20B; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5689889 |
| Synonyms: |
Slc6a20bem1J |
| Gene: |
Slc6a20b Location: Chr9:123422888-123461603 bp, - strand Genetic Position: Chr9, 74.19 cM, cytoband F4
|
| Alliance: |
Slc6a20bem1(IMPC)J page
|
| IMPC: |
Slc6a20b gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele from project Slc6a20b-6846J-M9395 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AGAGGATACAGGCCTCTAGG, ACTTCAATGTCATCAACACC and TCTGTCCTAGGGATCTTTAC, which resulted in a 183 bp deletion beginning at Chromosome 9 negative strand position 123,610,427 bp, TTACAGGTTGGGCTATTCACA, and ending after GGGAGAGGATACAGGCCTC, at 123,610,245 bp (GRCm38/mm10) in intron 4. This 183 bp mutation completely deletes exon 3 and flanking intronic sequences. It is predicted to result in a change in amino acid sequence after amino acid 131 and early truncation 10 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|