About   Help   FAQ
Slc6a20bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc6a20bem1(IMPC)J
Name: solute carrier family 6 (neurotransmitter transporter), member 20B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5689889
Synonyms: Slc6a20bem1J
Gene: Slc6a20b  Location: Chr9:123422888-123461603 bp, - strand  Genetic Position: Chr9, 74.19 cM, cytoband F4
Alliance: Slc6a20bem1(IMPC)J page
IMPC: Slc6a20b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Slc6a20b-6846J-M9395 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AGAGGATACAGGCCTCTAGG, ACTTCAATGTCATCAACACC and TCTGTCCTAGGGATCTTTAC, which resulted in a 183 bp deletion beginning at Chromosome 9 negative strand position 123,610,427 bp, TTACAGGTTGGGCTATTCACA, and ending after GGGAGAGGATACAGGCCTC, at 123,610,245 bp (GRCm38/mm10) in intron 4. This 183 bp mutation completely deletes exon 3 and flanking intronic sequences. It is predicted to result in a change in amino acid sequence after amino acid 131 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc6a20b Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory