E130311K13Rik^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: E130311K13Rik^em1(IMPC)J
• Name: RIKEN cDNA E130311K13 gene; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5689821
• Synonyms: E130311K13Rik^em1J
• Gene: E130311K13Rik Location: Chr3:63822105-63836893 bp, - strand Genetic Position: Chr3, 30.08 cM
• Alliance: E130311K13Rik^em1(IMPC)J page
• IMPC: E130311K13Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project E130311K13RIK-7012J-M2RMP1 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AACAACTGTAGTGATTGTTA, AGAAAGAAAGTTAAACTACG, and TGTCTTCTTGTTAAATGCTT, which resulted in a 139 bp deletion beginning in intron 3 at Chromosome 3 negative strand position 63,925,555 bp, TAAATGCTTAGGTATCTTCACAT, and ending after AAGAAAGAAAGTTAAACTACG at 63,925,417bp(GRCm38/mm10) in exon 3. This mutation deletes the splice acceptor as well as 64bp from exon 3 essentially removing the entire exon. This mutation is predicted to result in amino acid sequence change after 58 residues and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any E130311K13Rik Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)