Sprr1a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sprr1a^em1(IMPC)J
• Name: small proline-rich protein 1A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5688853
• Synonyms: Sprr1a^em1J, Sprr1a^hypo
• Gene: Sprr1a Location: Chr3:92391261-92393188 bp, - strand Genetic Position: Chr3, 40.14 cM
• Alliance: Sprr1a^em1(IMPC)J page
• IMPC: Sprr1a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Hypomorph)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Sprr1a-7038J-M1170 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, TCGGGAACAACAGGGTGGCA, and GGGTTGCAGGGCTCAGGAAC, which resulted in a 237 bp deletion beginning in exon 2 at Chromosome 3 negative strand position 92,484,565 bp, CTGTTCCTGAGCCCTGCAAC, and ending after GGCGCCTGAGCCCTGCCACC at 92,484,329 bp (GRCm38/mm10) in exon 2. This mutation results in the deletion in exon 2 of 237 bp and results in an amino acid change after 44 residues and early truncation 21 amino acids later. (J:188991, J:338379)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sprr1a Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)