Arhgap36^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arhgap36^em1(IMPC)J
• Name: Rho GTPase activating protein 36; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5688777
• Synonyms: Arhgap36^em1J
• Gene: Arhgap36 Location: ChrX:48552822-48589121 bp, + strand Genetic Position: ChrX, 25.95 cM
• Alliance: Arhgap36^em1(IMPC)J page
• IMPC: Arhgap36 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Arhgap36-7011J-LMP1 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GATCCAGCCTATGATGGACA, TCTCACGAAAAAACTCCTTG, and TGCCCTCCATTGTTGGAGCA, which resulted in a 163 bp deletion beginning in intron 7 at Chromosome X positive strand position 49,496,368 bp, CTTGAAGAACTGTTCAAGAT and ending after CTGAGCTCCTCAAGGAGTTTTTT at 49,496,530 bp (GRCm38/mm10) in exon 7. This 163 bp deletion removes the splice acceptor and 90 bp of exon 7 effectively deleting the entire exon and is predicted to result in early truncation 257 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Arhgap36 Mutation: 4 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)