Arhgap36^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arhgap36^em1(IMPC)J
• Name: Rho GTPase activating protein 36; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5688777
• Synonyms: Arhgap36^em1J
• Gene: Arhgap36 Location: ChrX:48552822-48589121 bp, + strand Genetic Position: ChrX, 25.95 cM
• Alliance: Arhgap36^em1(IMPC)J page
• IMPC: Arhgap36 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GATCCAGCCTATGATGGACA, TCTCACGAAAAAACTCCTTG, and TGCCCTCCATTGTTGGAGCA that targeted exon(s) ENSMUSE00000311854.2. This resulted in deletion(s) of 4 bp (location: ChrX:48585135-48585138; GRCm39), 163 bp (location: ChrX:48585245-48585407; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Arhgap36 Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)