About   Help   FAQ
Cdrt4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdrt4em1(IMPC)J
Name: CMT1A duplicated region transcript 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5688776
Synonyms: Cdrt4em1J
Gene: Cdrt4  Location: Chr11:62842019-62883921 bp, + strand  Genetic Position: Chr11, 38.84 cM, cytoband B2
Alliance: Cdrt4em1(IMPC)J page
IMPC: Cdrt4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Cdrt4-7035J-M1117 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences, GCATCTGTCACGGTGAGTAG, CTGGCTACTGAACCACCTCA, ACAAAGAGGGAAGGCTAGTC, and AGGGCATGACCCATAGAGTT, which resulted in a 396 bp deletion beginning before the 5 UTR at Chromosome 11 positive strand position 62,951,152 bp, GTCACAATGCCTCTACTCACCG, and ending after CAAGATCACAGTTCACATCACCT at 62,951,547 bp (GRCm38/mm10) in intron 2. This mutation deletes exon 1 and is predicted to result in a null allele. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cdrt4 Mutation:  10 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/07/2024
MGI 6.23
The Jackson Laboratory