About   Help   FAQ
Arap3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arap3em1(IMPC)J
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5688575
Synonyms: Arap3em1J
Gene: Arap3  Location: Chr18:38105681-38132022 bp, - strand  Genetic Position: Chr18, 19.85 cM
Alliance: Arap3em1(IMPC)J page
IMPC: Arap3 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Arap3-7000J-M3454 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AGGGGTCTGATCCCGAGGAG, GCATCAGTGCTACAGGACAC, and AAAGTCTGAGGCTTGGACAG, which resulted in a 775bp deletion beginning in intron 2 at Chromosome 18 negative strand position 37,997,244 bp, TTTGGGCATTCTTCTTTGAAAGAGAT, and ending after ATTTCCTTTCAGGACTCCAGATA at 37,996,470 bp (GRCm38/mm10) in exon 3. This mutation results in the deletion of exon 2, which includes the start of translation, intervening intron and 11 bp in exon 3 and is predicted to be a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Arap3 Mutation:  61 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory