Arap3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arap3^em1(IMPC)J
• Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5688575
• Synonyms: Arap3^em1J
• Gene: Arap3 Location: Chr18:38105681-38132022 bp, - strand Genetic Position: Chr18, 19.85 cM
• Alliance: Arap3^em1(IMPC)J page
• IMPC: Arap3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Arap3-7000J-M3454 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, AGGGGTCTGATCCCGAGGAG, GCATCAGTGCTACAGGACAC, and AAAGTCTGAGGCTTGGACAG, which resulted in a 775bp deletion beginning in intron 2 at Chromosome 18 negative strand position 37,997,244 bp, TTTGGGCATTCTTCTTTGAAAGAGAT, and ending after ATTTCCTTTCAGGACTCCAGATA at 37,996,470 bp (GRCm38/mm10) in exon 3. This mutation results in the deletion of exon 2, which includes the start of translation, intervening intron and 11 bp in exon 3 and is predicted to be a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Arap3 Mutation: 61 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)